Chłoniak pochodzenia dawcy Występujący w Porta Hepatis z przeszczepionej wątroby ad

Kolekcje płynów znajdują się za lewym płatem i wzdłuż prawego płata (proste strzałki). Rycina 2. Rycina 2. Obrazowanie metodą rezonansu magnetycznego Potwierdzenie obecności masy w porębieniu Porta Hepatis i dylatacji dróg żółciowych na obrazach obciążonych T1 (panel A) i T2 (panel B). Hiperintensywny wygląd dwóch zbiorów płynów na obrazie ważonym T odzwierciedla obecność produktów rozpadu krwi w krwiakach.
Naczyniowa ultrasonografia przeprowadzona w pierwszym dniu szpitalnym wykazała żyłę wrotną z patologicznego skrzydła. Przezskórna biopsja wątroby, przeprowadzona w drugim dniu hospitalizacji, wykazała makrofalowe stłuszczeniowe zapalenie wątroby z ciałami Mallory ego. Skorygowany kontrastowo tomograficzny tomograf komputerowy brzucha wykazał masę 4 cm w wątrobie i wewnątrzwątrobowej dylatacji (Figura 1). Ponadto, do lewego płata wątroby była 3-centymetrowa masa do tyłu i niewielki zbiór płynu przylegający do prawego płata wątroby. Rezonans magnetyczny wątroby wykazał, że chociaż masa w porta hepatis była stała, dwie pozostałe kolekcje płynu widoczne w tomografii komputerowej to krwiaki (ryc. 2). Cholangiogram T-rurki uzyskany w celu oceny dróg żółciowych nie zapewnił odpowiedniego wstecznego wypełnienia żółciowego drzewa. Endoskopowa cholangiopankreatografia wsteczna wykazała zwężenie odcinka przewodu żółciowego wspólnego proksymalnie do rurki T, najwyraźniej spowodowane kompresją zewnętrzną.
Ryc. 3. Ryc. 3. Złośliwy chłoniak wielkokomórkowy z dużych komórek w Porta Hepatis. Guz składa się z dużych atypowych komórek limfoidalnych z jądrem pęcherzykowym, grubej chromatyny obwodowej i wybitnych jąder komórkowych (hematoksylina i eozyna, x340).
Badanie laparotomii ujawniło masę o wymiarach 3 na 4 cm na wnęce wątroby, otaczającej wspólny przewód żółciowy alloprzeszczepu. Przeprowadzono oddzielne nacięcie biopsji tej masy i wątroby. Masę sklasyfikowano jako złośliwą, rozlaną chłoniak z dużych komórek linii komórkowej B (ryc. 3). Dalsze staging nie ujawnił żadnych innych miejsc choroby. Rozpoczęto radioterapię ukierunkowaną na obszar masy i pierwotne drenażowe węzły chłonne. Dzienna dawka cyklosporyny została zmniejszona do 2,5 mg na kilogram, a leczenie azatiopryną ponownie przerwano.
Metody
DNA wyizolowano z krwi pacjenta i zamrożonej próbki nowotworu, jak opisano wcześniej11. Fragmenty DNA z locus D4S174 wytworzono za pomocą PCR w objętości 25 mikrolitrów zawierających 2,5 pmola pary primerów (5 AAGAACCATGCGATACGACT3 i 5 CATTCCTAGATGGGTAAAGC3 ), 50 ng DNA, 0,2 mmol (na świeżą lub zamrożoną tkankę). ) lub 2 mmole (w przypadku próbek zatopionych w parafinie) trifosforanu deoksyadenozyny, trifosforanu deoksytymidyny i trifosforanu deoksyguanozyny; 2 .mol trifosforanu deoksycytydyny na litr; 1,5 mmol chlorku magnezu na litr; 20 mmol buforu TRIS na litr (pH 8,6); 50 mmol chlorku potasu na litr; 50 .g albuminy surowicy bydlęcej na mililitr; 0,5 U (dla świeżej lub zamrożonej tkanki) lub U (dla próbek zatopionych w parafinie) polimerazy Taq (Perkin-Elmer Cetus); i 0,1 mikrolitra (7 nmoli na litr) [a-32P] trifosforanu deoksycytydyny (3000 Ci na milimol)
[więcej w: gastropatia rumieniowa, provita bolesławiec, laparoskopia woreczka żółciowego ]